Looping with Globs

It can be tedious and error prone to individually specify the files we want to loop over. Regular expressions, in the form of bash globs allow us to automatically select groups of files to loop over.

Shell Variables

Assign the variables in this notebook.

[1]:
source bioinf_intro_config.sh
mkdir -p $TRIMMED $STAR_OUT

Globs?

Previously we specified the files we wanted to loop over explicitly:

[2]:
for FASTQ in 21_2019_P_M1_S21_L002_R1 21_2019_P_M1_S21_L001_R1
    do
        echo "RUNNING FASTQ: ${FASTQ}"
    done
RUNNING FASTQ: 21_2019_P_M1_S21_L002_R1
RUNNING FASTQ: 21_2019_P_M1_S21_L001_R1

This is appropriate in some situations, but often when there is a group of files that we want to work with, we can find a simple way to list these files without specifying them one-by-one. For example, since the reads for each FASTQ are split across four lanes, we might want to analyze the data from all four lanes at once. There are several ways that we can specify the FASTQs from all four lanes of FASTQ 21_2019:

  1. The easiest is to use the * wildcard, which matches any number of any characters (including zero), so we can match the FASTQs from all four lanes like this: $RAW_FASTQS/21_2019*

  2. * is easy and useful, but often it is better to be more specific, otherwise we might match something unintentionally. Since the only difference in the names between the lanes is the “L001”, “L002”, “L003”, and “L004”, we can narrow our match using ?, which matches any single character: 21_2019_P_M1_S21_L00?_R1_001.fastq.gz

  3. The best approach is to specify exactly what characters we are allowing in that variable position. Square brackets allow you to list specific characters that can match [1234] or a range [1-4]: 21_2019_P_M1_S21_L00[1-4]_R1_001.fastq.gz

Globs can be confusing. Keep in mind that here we are using the globs to search through all the file names in a directory and list the files with a name that matches a specific pattern.

[3]:
echo $RAW_FASTQS/21_2019*
/data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L001_R1_001.fastq.gz /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L003_R1_001.fastq.gz /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L004_R1_001.fastq.gz
[4]:
echo $RAW_FASTQS/21_2019_P_M1_S21_L00?_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L001_R1_001.fastq.gz /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L003_R1_001.fastq.gz /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L004_R1_001.fastq.gz
[5]:
echo $RAW_FASTQS/21_2019_P_M1_S21_L00[1234]_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L001_R1_001.fastq.gz /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L003_R1_001.fastq.gz /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L004_R1_001.fastq.gz
[6]:
echo $RAW_FASTQS/21_2019_P_M1_S21_L00[1-4]_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L001_R1_001.fastq.gz /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L003_R1_001.fastq.gz /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L004_R1_001.fastq.gz

More Complex Globs

We can combine multiple wildcards in a glob to match a more complex set of filenames. For example we could match “2019” samples 10 through 19, Lanes 1 through 4, with the following glob.

[7]:
ls $RAW_FASTQS/1?_2019_*_L00[1-4]_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/10_2019_P_M1_S10_L001_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/10_2019_P_M1_S10_L002_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/10_2019_P_M1_S10_L003_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/10_2019_P_M1_S10_L004_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/11_2019_P_M1_S11_L001_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/11_2019_P_M1_S11_L002_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/11_2019_P_M1_S11_L003_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/11_2019_P_M1_S11_L004_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/12_2019_P_M1_S12_L001_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/12_2019_P_M1_S12_L002_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/12_2019_P_M1_S12_L003_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/12_2019_P_M1_S12_L004_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/13_2019_P_M1_S13_L001_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/13_2019_P_M1_S13_L002_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/13_2019_P_M1_S13_L003_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/13_2019_P_M1_S13_L004_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/14_2019_P_M1_S14_L001_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/14_2019_P_M1_S14_L002_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/14_2019_P_M1_S14_L003_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/14_2019_P_M1_S14_L004_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/15_2019_P_M1_S15_L001_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/15_2019_P_M1_S15_L002_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/15_2019_P_M1_S15_L003_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/15_2019_P_M1_S15_L004_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/16_2019_P_M1_S16_L001_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/16_2019_P_M1_S16_L002_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/16_2019_P_M1_S16_L003_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/16_2019_P_M1_S16_L004_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/17_2019_P_M1_S17_L001_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/17_2019_P_M1_S17_L002_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/17_2019_P_M1_S17_L003_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/17_2019_P_M1_S17_L004_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/18_2019_P_M1_S18_L001_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/18_2019_P_M1_S18_L002_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/18_2019_P_M1_S18_L003_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/18_2019_P_M1_S18_L004_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/19_2019_P_M1_S19_L001_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/19_2019_P_M1_S19_L002_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/19_2019_P_M1_S19_L003_R1_001.fastq.gz
/data/hts_2019_data/hts2019_pilot_rawdata/19_2019_P_M1_S19_L004_R1_001.fastq.gz

Looping over a glob

Now we can put together for loops with globs, to loop over all the lanes from library 21_2019

[8]:
for FASTQ in $RAW_FASTQS/21_2019_P_M1_S21_L00[1-4]_R1_001.fastq.gz
    do
        echo "RUNNING FASTQ: ${FASTQ}"
    done
RUNNING FASTQ: /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L001_R1_001.fastq.gz
RUNNING FASTQ: /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz
RUNNING FASTQ: /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L003_R1_001.fastq.gz
RUNNING FASTQ: /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L004_R1_001.fastq.gz

String Manipulation

But we still have a bit of work to do. Before when we were manually specifying each FASTQ, we looped over a substring of the full path, then added on the prefix and suffix, for example: $TRIMMED/${FASTQ}_001.trim.fastq.gz. But now we are grabbing the full path, and we need to manipulate it so that we can generate output file names that are different than the input, and put the output in different directories. We can do all this with the basename bash function. The simple form of basename removes the whole directory portion of a path and just returns the filename:

[9]:
for FASTQ in $RAW_FASTQS/21_2019_P_M1_S21_L00[1-2]_R1_001.fastq.gz
    do
        echo "FULL PATH IS: ${FASTQ}"
        echo "basename gives us: $(basename ${FASTQ})"
        echo ""
    done
FULL PATH IS: /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L001_R1_001.fastq.gz
basename gives us: 21_2019_P_M1_S21_L001_R1_001.fastq.gz

FULL PATH IS: /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz
basename gives us: 21_2019_P_M1_S21_L002_R1_001.fastq.gz

If you give basename a string as a second argument, it will strip that string from the end of the path (if it is there):

[10]:
for FASTQ in $RAW_FASTQS/21_2019_P_M1_S21_L00[1-2]_R1_001.fastq.gz
    do
        echo "FULL PATH IS: ${FASTQ}"
        echo "basename gives us: $(basename ${FASTQ} '_001.fastq.gz')"
        echo ""
    done
FULL PATH IS: /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L001_R1_001.fastq.gz
basename gives us: 21_2019_P_M1_S21_L001_R1

FULL PATH IS: /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz
basename gives us: 21_2019_P_M1_S21_L002_R1

Note that if the string you give is not a suffix of the path, nothing is stripped from the end of the path, but the directory prefix will still be removed:

[11]:
for FASTQ in $RAW_FASTQS/21_2019_P_M1_S21_L00[1-2]_R1_001.fastq.gz
    do
        echo "FULL PATH IS: ${FASTQ}"
        echo "with '_001.fastq.gz': $(basename ${FASTQ} '_001.fastq.gz')"
        echo "with 'fastq':         $(basename ${FASTQ} 'fastq')"
        echo "with 'foo':           $(basename ${FASTQ} 'foo')"
        echo ""
    done
FULL PATH IS: /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L001_R1_001.fastq.gz
with '_001.fastq.gz': 21_2019_P_M1_S21_L001_R1
with 'fastq':         21_2019_P_M1_S21_L001_R1_001.fastq.gz
with 'foo':           21_2019_P_M1_S21_L001_R1_001.fastq.gz

FULL PATH IS: /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz
with '_001.fastq.gz': 21_2019_P_M1_S21_L002_R1
with 'fastq':         21_2019_P_M1_S21_L002_R1_001.fastq.gz
with 'foo':           21_2019_P_M1_S21_L002_R1_001.fastq.gz

And we can assign the results of basename to a variable for later use:

[12]:
for FASTQ in $RAW_FASTQS/21_2019_P_M1_S21_L00[1-2]_R1_001.fastq.gz
    do
        echo "FULL PATH IS: ${FASTQ}"
        FASTQ_BASE="$(basename ${FASTQ} '_001.fastq.gz')"
        echo "basename gives us: $FASTQ_BASE"
        echo "OUTPUT PATH: ${TRIMMED}/${FASTQ_BASE}_001.trim.fastq.gz"
    done
FULL PATH IS: /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L001_R1_001.fastq.gz
basename gives us: 21_2019_P_M1_S21_L001_R1
OUTPUT PATH: /home/jovyan/work/scratch/bioinf_intro/trimmed_fastqs/21_2019_P_M1_S21_L001_R1_001.trim.fastq.gz
FULL PATH IS: /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz
basename gives us: 21_2019_P_M1_S21_L002_R1
OUTPUT PATH: /home/jovyan/work/scratch/bioinf_intro/trimmed_fastqs/21_2019_P_M1_S21_L002_R1_001.trim.fastq.gz

With globs and basename in our toolbox, we are ready to conquer the world or at least run multiple FASTQs through our pipeline, without breaking a sweat!

A globy pipeline

[13]:
for FASTQ in $RAW_FASTQS/21_2019_P_M1_S21_L00[1-2]_R1_001.fastq.gz
    do
        FASTQ_BASE="$(basename ${FASTQ} '_001.fastq.gz')"
        echo "---------------- TRIMMING: $FASTQ_BASE ----------------"
        fastq-mcf \
            $MYINFO/neb_e7600_adapters.fasta \
            $RAW_FASTQS/${FASTQ_BASE}_001.fastq.gz \
            -q 20 -x 0.5 \
            -o $TRIMMED/${FASTQ_BASE}_001.trim.fastq.gz

        echo "---------------- MAPPING: $FASTQ_BASE ----------------"
        STAR \
            --runMode alignReads \
            --twopassMode None \
            --genomeDir $GENOME_DIR \
            --readFilesIn $TRIMMED/${FASTQ_BASE}_001.trim.fastq.gz \
            --readFilesCommand gunzip -c \
            --outFileNamePrefix ${STAR_OUT}/${FASTQ_BASE}_ \
            --quantMode GeneCounts \
            --outSAMtype BAM SortedByCoordinate \
            --runThreadN 2
    done
---------------- TRIMMING: 21_2019_P_M1_S21_L001_R1 ----------------
Command Line: /home/jovyan/work/scratch/bioinf_intro/myinfo/neb_e7600_adapters.fasta /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L001_R1_001.fastq.gz -q 20 -x 0.5 -o /home/jovyan/work/scratch/bioinf_intro/trimmed_fastqs/21_2019_P_M1_S21_L001_R1_001.trim.fastq.gz
Scale used: 2.2
Phred: 33
Threshold used: 751 out of 300000
Adapter Adapter (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA): counted 2504 at the 'end' of '/data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L001_R1_001.fastq.gz', clip set to 6
Files: 1
Total reads: 2479050
Too short after clip: 1519
Clipped 'end' reads: Count: 46013, Mean: 15.47, Sd: 8.24
Trimmed 299018 reads by an average of 1.71 bases on quality < 20
---------------- MAPPING: 21_2019_P_M1_S21_L001_R1 ----------------
Jun 26 16:30:37 ..... started STAR run
Jun 26 16:30:37 ..... loading genome
Jun 26 16:30:38 ..... started mapping
Jun 26 16:32:13 ..... started sorting BAM
Jun 26 16:32:20 ..... finished successfully
---------------- TRIMMING: 21_2019_P_M1_S21_L002_R1 ----------------
Command Line: /home/jovyan/work/scratch/bioinf_intro/myinfo/neb_e7600_adapters.fasta /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz -q 20 -x 0.5 -o /home/jovyan/work/scratch/bioinf_intro/trimmed_fastqs/21_2019_P_M1_S21_L002_R1_001.trim.fastq.gz
Scale used: 2.2
Phred: 33
Threshold used: 751 out of 300000
Adapter Adapter (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA): counted 2515 at the 'end' of '/data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz', clip set to 6
Files: 1
Total reads: 2437108
Too short after clip: 1347
Clipped 'end' reads: Count: 44977, Mean: 15.55, Sd: 8.27
Trimmed 288960 reads by an average of 1.70 bases on quality < 20
---------------- MAPPING: 21_2019_P_M1_S21_L002_R1 ----------------
Jun 26 16:32:36 ..... started STAR run
Jun 26 16:32:36 ..... loading genome
Jun 26 16:32:40 ..... started mapping
Jun 26 16:34:08 ..... started sorting BAM
Jun 26 16:34:13 ..... finished successfully

And let’s check the result

[14]:
ls ${STAR_OUT}
21_2019_P_M1_S21_L001_R1_Aligned.sortedByCoord.out.bam
21_2019_P_M1_S21_L001_R1_Log.final.out
21_2019_P_M1_S21_L001_R1_Log.out
21_2019_P_M1_S21_L001_R1_Log.progress.out
21_2019_P_M1_S21_L001_R1_ReadsPerGene.out.tab
21_2019_P_M1_S21_L001_R1_short_introns_Aligned.sortedByCoord.out.bam
21_2019_P_M1_S21_L001_R1_short_introns_Aligned.sortedByCoord.out.bam.bai
21_2019_P_M1_S21_L001_R1_short_introns_Log.final.out
21_2019_P_M1_S21_L001_R1_short_introns_Log.out
21_2019_P_M1_S21_L001_R1_short_introns_Log.progress.out
21_2019_P_M1_S21_L001_R1_short_introns_ReadsPerGene.out.tab
21_2019_P_M1_S21_L001_R1_short_introns_SJ.out.tab
21_2019_P_M1_S21_L001_R1_SJ.out.tab
21_2019_P_M1_S21_L002_R1_Aligned.out.bam
21_2019_P_M1_S21_L002_R1_Aligned.sortedByCoord.out.bam
21_2019_P_M1_S21_L002_R1_Log.final.out
21_2019_P_M1_S21_L002_R1_Log.out
21_2019_P_M1_S21_L002_R1_Log.progress.out
21_2019_P_M1_S21_L002_R1_ReadsPerGene.out.tab
21_2019_P_M1_S21_L002_R1_short_introns_Aligned.sortedByCoord.out.bam
21_2019_P_M1_S21_L002_R1_short_introns_Aligned.sortedByCoord.out.bam.bai
21_2019_P_M1_S21_L002_R1_short_introns_Log.final.out
21_2019_P_M1_S21_L002_R1_short_introns_Log.out
21_2019_P_M1_S21_L002_R1_short_introns_Log.progress.out
21_2019_P_M1_S21_L002_R1_short_introns_ReadsPerGene.out.tab
21_2019_P_M1_S21_L002_R1_short_introns_SJ.out.tab
21_2019_P_M1_S21_L002_R1_SJ.out.tab
21_2019_P_M1_S21_L003_R1_Log.final.out
21_2019_P_M1_S21_L003_R1_Log.out
21_2019_P_M1_S21_L003_R1_Log.progress.out
21_2019_P_M1_S21_L003_R1_ReadsPerGene.out.tab
21_2019_P_M1_S21_L003_R1_SJ.out.tab
genome_Log.out
multiqc_data
multiqc_report.html
[15]:
head ${STAR_OUT}/21_2019_P_M1_S21_L00?_R1_ReadsPerGene.out.tab
==> /home/jovyan/work/scratch/bioinf_intro/star_out/21_2019_P_M1_S21_L001_R1_ReadsPerGene.out.tab <==
N_unmapped      47582   47582   47582
N_multimapping  35895   35895   35895
N_noFeature     12476   2181458 18846
N_ambiguous     206438  870     288
CNAG_04548      0       0       0
CNAG_07303      0       0       0
CNAG_07304      10      0       10
CNAG_00001      0       0       0
CNAG_07305      2       0       2
CNAG_00002      43      0       43

==> /home/jovyan/work/scratch/bioinf_intro/star_out/21_2019_P_M1_S21_L002_R1_ReadsPerGene.out.tab <==
N_unmapped      46060   46060   46060
N_multimapping  35006   35006   35006
N_noFeature     12466   2145291 18783
N_ambiguous     203327  820     316
CNAG_04548      0       0       0
CNAG_07303      0       0       0
CNAG_07304      6       0       6
CNAG_00001      0       0       0
CNAG_07305      1       0       1
CNAG_00002      51      0       51

==> /home/jovyan/work/scratch/bioinf_intro/star_out/21_2019_P_M1_S21_L003_R1_ReadsPerGene.out.tab <==
N_unmapped      47625   47625   47625
N_multimapping  36124   36124   36124
N_noFeature     12566   2207478 19048
N_ambiguous     208095  881     289
CNAG_04548      0       0       0
CNAG_07303      0       0       0
CNAG_07304      16      0       16
CNAG_00001      0       0       0
CNAG_07305      0       0       0
CNAG_00002      53      0       53

Glob References