{ "cells": [ { "cell_type": "markdown", "metadata": {}, "source": [ "# Making Generic Commands\n", "Let's let put the Bash shell to work for us by being smart with our variables\n", "\n", "## Shell Variables\n", "Assign the variables in this notebook." ] }, { "cell_type": "code", "execution_count": 1, "metadata": {}, "outputs": [], "source": [ "source bioinf_intro_config.sh\n", "mkdir -p $TRIMMED $STAR_OUT" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Using a *FASTQ* variable\n", "Most of the commands in our pipeline are complicated! To apply our pipeline to different FASTQs, we need to change things in multiple places. For example, just to run trimming with fastq-mcf, we need to change things in two places between each run: the input FASTQ and the output FASTQ. If we were doing this with paired-end reads, we would have to change four things. Doing this by hand is not only tedious, but error prone. Doing almost the same thing repeatedly is something that people are bad at, but computers are very good at! So let's get the computer to do the hard work. Because the Bash shell is almost magical (it is a full fledged programming language), we can do this easily." ] }, { "cell_type": "code", "execution_count": 2, "metadata": {}, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "RUNNING FASTQ: ~~~~A~~~~\n", "TRIMING: A\n", "MAPPING: A\n" ] } ], "source": [ "FASTQ=\"A\"\n", "echo \"RUNNING FASTQ: ~~~~${FASTQ}~~~~\"\n", "echo \"TRIMING: ${FASTQ}\"\n", "echo \"MAPPING: ${FASTQ}\"" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "The `for` loop in Bash is conceptually the same as in any other programming language, although the syntax may be different. The `do` and `done` are essential - `do` needs to be before the \"loop body\" (what is going to be repeated) and `done` needs to be after it.\n", "\n", "So let's try something almost useful:" ] }, { "cell_type": "code", "execution_count": 3, "metadata": {}, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "RUNNING FASTQ: ~~~~21_2019_P_M1_S21_L002_R1~~~~\n", "TRIMING: 21_2019_P_M1_S21_L002_R1\n", "MAPPING: 21_2019_P_M1_S21_L002_R1\n" ] } ], "source": [ "FASTQ=\"21_2019_P_M1_S21_L002_R1\"\n", "echo \"RUNNING FASTQ: ~~~~${FASTQ}~~~~\"\n", "echo \"TRIMING: ${FASTQ}\"\n", "echo \"MAPPING: ${FASTQ}\"" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Now for the real thing . . .\n", "### Let's run fastq-mcf:" ] }, { "cell_type": "code", "execution_count": 4, "metadata": {}, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "TRIMING: 21_2019_P_M1_S21_L002_R1\n", "Command Line: /home/jovyan/work/scratch/bioinf_intro/myinfo/neb_e7600_adapters.fasta /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz -q 20 -x 0.5 -o /home/jovyan/work/scratch/bioinf_intro/trimmed_fastqs/21_2019_P_M1_S21_L002_R1_001.trim.fastq.gz\n", "Scale used: 2.2\n", "Phred: 33\n", "Threshold used: 751 out of 300000\n", "Adapter Adapter (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA): counted 2515 at the 'end' of '/data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz', clip set to 6\n", "Files: 1\n", "Total reads: 2437108\n", "Too short after clip: 1347\n", "Clipped 'end' reads: Count: 44977, Mean: 15.55, Sd: 8.27\n", "Trimmed 288960 reads by an average of 1.70 bases on quality < 20\n" ] } ], "source": [ "FASTQ=\"21_2019_P_M1_S21_L002_R1\"\n", "echo \"TRIMING: $FASTQ\"\n", "fastq-mcf $MYINFO/neb_e7600_adapters.fasta \\\n", " $RAW_FASTQS/${FASTQ}_001.fastq.gz \\\n", " -q 20 -x 0.5 \\\n", " -o $TRIMMED/${FASTQ}_001.trim.fastq.gz" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "### Now let's do the same thing for STAR" ] }, { "cell_type": "code", "execution_count": 5, "metadata": {}, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "MAPPING: 21_2019_P_M1_S21_L002_R1\n", "Jun 26 16:18:39 ..... started STAR run\n", "Jun 26 16:18:39 ..... loading genome\n", "Jun 26 16:18:39 ..... started mapping\n", "Jun 26 16:20:03 ..... finished successfully\n" ] } ], "source": [ "FASTQ=\"21_2019_P_M1_S21_L002_R1\"\n", "echo \"MAPPING: $FASTQ\"\n", "STAR \\\n", " --runMode alignReads \\\n", " --twopassMode None \\\n", " --genomeDir $GENOME_DIR \\\n", " --readFilesIn $TRIMMED/${FASTQ}_001.trim.fastq.gz \\\n", " --readFilesCommand gunzip -c \\\n", " --outFileNamePrefix ${STAR_OUT}/${FASTQ}_ \\\n", " --quantMode GeneCounts \\\n", " --outSAMtype None \\\n", " --runThreadN 2" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "### And let's check the result" ] }, { "cell_type": "code", "execution_count": 6, "metadata": {}, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "21_2019_P_M1_S21_L001_R1_short_introns_Aligned.sortedByCoord.out.bam\n", "21_2019_P_M1_S21_L001_R1_short_introns_Aligned.sortedByCoord.out.bam.bai\n", "21_2019_P_M1_S21_L001_R1_short_introns_Log.final.out\n", "21_2019_P_M1_S21_L001_R1_short_introns_Log.out\n", "21_2019_P_M1_S21_L001_R1_short_introns_Log.progress.out\n", "21_2019_P_M1_S21_L001_R1_short_introns_ReadsPerGene.out.tab\n", "21_2019_P_M1_S21_L001_R1_short_introns_SJ.out.tab\n", "21_2019_P_M1_S21_L002_R1_Aligned.out.bam\n", "21_2019_P_M1_S21_L002_R1_Log.final.out\n", "21_2019_P_M1_S21_L002_R1_Log.out\n", "21_2019_P_M1_S21_L002_R1_Log.progress.out\n", "21_2019_P_M1_S21_L002_R1_ReadsPerGene.out.tab\n", "21_2019_P_M1_S21_L002_R1_short_introns_Aligned.sortedByCoord.out.bam\n", "21_2019_P_M1_S21_L002_R1_short_introns_Aligned.sortedByCoord.out.bam.bai\n", "21_2019_P_M1_S21_L002_R1_short_introns_Log.final.out\n", "21_2019_P_M1_S21_L002_R1_short_introns_Log.out\n", "21_2019_P_M1_S21_L002_R1_short_introns_Log.progress.out\n", "21_2019_P_M1_S21_L002_R1_short_introns_ReadsPerGene.out.tab\n", "21_2019_P_M1_S21_L002_R1_short_introns_SJ.out.tab\n", "21_2019_P_M1_S21_L002_R1_SJ.out.tab\n", "genome_Log.out\n", "\u001b[0m\u001b[01;34mmultiqc_data\u001b[0m\n", "multiqc_report.html\n" ] } ], "source": [ "ls ${STAR_OUT}" ] }, { "cell_type": "code", "execution_count": 7, "metadata": { "scrolled": true }, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "N_unmapped\t46060\t46060\t46060\n", "N_multimapping\t35006\t35006\t35006\n", "N_noFeature\t12466\t2145291\t18783\n", "N_ambiguous\t203327\t820\t316\n", "CNAG_04548\t0\t0\t0\n", "CNAG_07303\t0\t0\t0\n", "CNAG_07304\t6\t0\t6\n", "CNAG_00001\t0\t0\t0\n", "CNAG_07305\t1\t0\t1\n", "CNAG_00002\t51\t0\t51\n" ] } ], "source": [ "head ${STAR_OUT}/${FASTQ}_ReadsPerGene.out.tab" ] } ], "metadata": { "kernelspec": { "display_name": "Bash", "language": "bash", "name": "bash" }, "language_info": { "codemirror_mode": "shell", "file_extension": ".sh", "mimetype": "text/x-sh", "name": "bash" } }, "nbformat": 4, "nbformat_minor": 1 }