{
 "cells": [
  {
   "cell_type": "code",
   "execution_count": 1,
   "metadata": {},
   "outputs": [],
   "source": [
    "source bioinf_intro_config.sh\n",
    "rm -rf $IGV_DIR $STAR_OUT\n",
    "mkdir -p $TRIMMED $STAR_OUT $IGV_DIR"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "# Run with shorter intron limit"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "IGV needs indices for the BAM files.  The index allows it to quickly load reads from different parts of the genome."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 2,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "---------------- TRIMMING: 21_2019_P_M1_S21_L001_R1 ----------------\n",
      "Command Line: /home/jovyan/work/scratch/bioinf_intro/myinfo/neb_e7600_adapters.fasta /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L001_R1_001.fastq.gz -q 20 -x 0.5 -o /home/jovyan/work/scratch/bioinf_intro/trimmed_fastqs/21_2019_P_M1_S21_L001_R1_001.trim.fastq.gz\n",
      "Scale used: 2.2\n",
      "Phred: 33\n",
      "Threshold used: 751 out of 300000\n",
      "Adapter Adapter (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA): counted 2504 at the 'end' of '/data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L001_R1_001.fastq.gz', clip set to 6\n",
      "Files: 1\n",
      "Total reads: 2479050\n",
      "Too short after clip: 1519\n",
      "Clipped 'end' reads: Count: 46013, Mean: 15.47, Sd: 8.24\n",
      "Trimmed 299018 reads by an average of 1.71 bases on quality < 20\n",
      "---------------- MAPPING: 21_2019_P_M1_S21_L001_R1 ----------------\n",
      "Jun 26 16:41:58 ..... started STAR run\n",
      "Jun 26 16:41:58 ..... loading genome\n",
      "Jun 26 16:42:02 ..... started mapping\n",
      "Jun 26 16:42:35 ..... started sorting BAM\n",
      "Jun 26 16:42:40 ..... finished successfully\n",
      "---------------- INDEXING BAM: 21_2019_P_M1_S21_L001_R1 ----------------\n",
      "---------------- TRIMMING: 21_2019_P_M1_S21_L002_R1 ----------------\n",
      "Command Line: /home/jovyan/work/scratch/bioinf_intro/myinfo/neb_e7600_adapters.fasta /data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz -q 20 -x 0.5 -o /home/jovyan/work/scratch/bioinf_intro/trimmed_fastqs/21_2019_P_M1_S21_L002_R1_001.trim.fastq.gz\n",
      "Scale used: 2.2\n",
      "Phred: 33\n",
      "Threshold used: 751 out of 300000\n",
      "Adapter Adapter (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA): counted 2515 at the 'end' of '/data/hts_2019_data/hts2019_pilot_rawdata/21_2019_P_M1_S21_L002_R1_001.fastq.gz', clip set to 6\n",
      "Files: 1\n",
      "Total reads: 2437108\n",
      "Too short after clip: 1347\n",
      "Clipped 'end' reads: Count: 44977, Mean: 15.55, Sd: 8.27\n",
      "Trimmed 288960 reads by an average of 1.70 bases on quality < 20\n",
      "---------------- MAPPING: 21_2019_P_M1_S21_L002_R1 ----------------\n",
      "Jun 26 16:42:58 ..... started STAR run\n",
      "Jun 26 16:42:58 ..... loading genome\n",
      "Jun 26 16:42:58 ..... started mapping\n",
      "Jun 26 16:43:30 ..... started sorting BAM\n",
      "Jun 26 16:43:35 ..... finished successfully\n",
      "---------------- INDEXING BAM: 21_2019_P_M1_S21_L002_R1 ----------------\n"
     ]
    }
   ],
   "source": [
    "for FASTQ in $RAW_FASTQS/21_2019_P_M1_S21_L00[1-2]_R1_001.fastq.gz\n",
    "    do\n",
    "        FASTQ_BASE=\"$(basename ${FASTQ} '_001.fastq.gz')\"\n",
    "        echo \"---------------- TRIMMING: $FASTQ_BASE ----------------\"\n",
    "        fastq-mcf \\\n",
    "            $MYINFO/neb_e7600_adapters.fasta \\\n",
    "            $RAW_FASTQS/${FASTQ_BASE}_001.fastq.gz \\\n",
    "            -q 20 -x 0.5 \\\n",
    "            -o $TRIMMED/${FASTQ_BASE}_001.trim.fastq.gz\n",
    "        \n",
    "        echo \"---------------- MAPPING: $FASTQ_BASE ----------------\"\n",
    "        STAR \\\n",
    "            --runMode alignReads \\\n",
    "            --twopassMode None \\\n",
    "            --genomeDir $GENOME_DIR \\\n",
    "            --readFilesIn $TRIMMED/${FASTQ_BASE}_001.trim.fastq.gz \\\n",
    "            --readFilesCommand gunzip -c \\\n",
    "            --outFileNamePrefix ${STAR_OUT}/${FASTQ_BASE}_short_introns_ \\\n",
    "            --quantMode GeneCounts \\\n",
    "            --outSAMtype BAM SortedByCoordinate \\\n",
    "            --alignIntronMax 5000 \\\n",
    "            --outSJfilterIntronMaxVsReadN 500 1000 2000  \\\n",
    "            --runThreadN 2\n",
    "            \n",
    "        echo \"---------------- INDEXING BAM: $FASTQ_BASE ----------------\"\n",
    "        samtools index ${STAR_OUT}/${FASTQ_BASE}_short_introns_Aligned.sortedByCoord.out.bam\n",
    "    done"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 3,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "total 204980\n",
      "-rw-r--r-- 1 jovyan users    166944 Jun 26 16:42 21_2019_P_M1_S21_L001_R1_short_introns_ReadsPerGene.out.tab\n",
      "-rw-r--r-- 1 jovyan users 104774284 Jun 26 16:42 21_2019_P_M1_S21_L001_R1_short_introns_Aligned.sortedByCoord.out.bam\n",
      "-rw-r--r-- 1 jovyan users    918773 Jun 26 16:42 21_2019_P_M1_S21_L001_R1_short_introns_SJ.out.tab\n",
      "-rw-r--r-- 1 jovyan users       246 Jun 26 16:42 21_2019_P_M1_S21_L001_R1_short_introns_Log.progress.out\n",
      "-rw-r--r-- 1 jovyan users     18641 Jun 26 16:42 21_2019_P_M1_S21_L001_R1_short_introns_Log.out\n",
      "-rw-r--r-- 1 jovyan users      1849 Jun 26 16:42 21_2019_P_M1_S21_L001_R1_short_introns_Log.final.out\n",
      "-rw-r--r-- 1 jovyan users     32536 Jun 26 16:42 21_2019_P_M1_S21_L001_R1_short_introns_Aligned.sortedByCoord.out.bam.bai\n",
      "-rw-r--r-- 1 jovyan users    166808 Jun 26 16:43 21_2019_P_M1_S21_L002_R1_short_introns_ReadsPerGene.out.tab\n",
      "-rw-r--r-- 1 jovyan users 102828697 Jun 26 16:43 21_2019_P_M1_S21_L002_R1_short_introns_Aligned.sortedByCoord.out.bam\n",
      "-rw-r--r-- 1 jovyan users    913218 Jun 26 16:43 21_2019_P_M1_S21_L002_R1_short_introns_SJ.out.tab\n",
      "-rw-r--r-- 1 jovyan users       246 Jun 26 16:43 21_2019_P_M1_S21_L002_R1_short_introns_Log.progress.out\n",
      "-rw-r--r-- 1 jovyan users     18643 Jun 26 16:43 21_2019_P_M1_S21_L002_R1_short_introns_Log.out\n",
      "-rw-r--r-- 1 jovyan users      1849 Jun 26 16:43 21_2019_P_M1_S21_L002_R1_short_introns_Log.final.out\n",
      "-rw-r--r-- 1 jovyan users     32248 Jun 26 16:43 21_2019_P_M1_S21_L002_R1_short_introns_Aligned.sortedByCoord.out.bam.bai\n"
     ]
    }
   ],
   "source": [
    "ls -ltr ${STAR_OUT}"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "#### Link Directory"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 5,
   "metadata": {},
   "outputs": [],
   "source": [
    "ln -s ${STAR_OUT}/*.bam* $GENOME_DIR/$GTF $GENOME_DIR/$FA $IGV_DIR"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "#### Tarring"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 6,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "igv/\n",
      "igv/Cryptococcus_neoformans_var_grubii_h99.CNA3.39.gtf\n",
      "igv/21_2019_P_M1_S21_L002_R1_short_introns_Aligned.sortedByCoord.out.bam\n",
      "igv/21_2019_P_M1_S21_L001_R1_short_introns_Aligned.sortedByCoord.out.bam.bai\n",
      "igv/Cryptococcus_neoformans_var_grubii_h99.CNA3.dna.toplevel.fa\n",
      "igv/21_2019_P_M1_S21_L002_R1_short_introns_Aligned.sortedByCoord.out.bam.bai\n",
      "igv/21_2019_P_M1_S21_L001_R1_short_introns_Aligned.sortedByCoord.out.bam\n"
     ]
    }
   ],
   "source": [
    "tar --dereference \\\n",
    "    --create \\\n",
    "    --gzip \\\n",
    "    --verbose \\\n",
    "    --file $CUROUT/stuff_for_igv.tgz \\\n",
    "    --directory $CUROUT \\\n",
    "    $(basename $IGV_DIR)"
   ]
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Bash",
   "language": "bash",
   "name": "bash"
  },
  "language_info": {
   "codemirror_mode": "shell",
   "file_extension": ".sh",
   "mimetype": "text/x-sh",
   "name": "bash"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 1
}